Learn More
Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO118
37.33 EUR valid until 2025-03-21
Use promo code "24111" to get your promotional price.
Alert:
To receive the discount customers must purchase three of the same product at list price in a single order to receive 33% discount. There is no limit to the multiples of 3 that customers can buy. Use promo code ”24111” to get your promotional price
Description
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'
Related products
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T3 promoter Sequencing Primer, 24-mer (SO120)
SP6 promoter Sequencing Primer, 18-mer (SO116)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.

Specifications
SP6, T3, T7 | |
T7 promoter Sequencing Primer, 20-mer, 10 μM Store at –20°C. |
|
10 μM | |
10 μM | |
Sequencing |
Sequencing Primer | |
Dry Ice | |
T7 | |
pTZ19R, pTZ57R, pBluescript II | |
Liquid |
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
For Research Use Only. Not for use in diagnostic procedures.