Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available.
Brand: Invitrogen™ N56002
236.01 EUR valid until 2025-03-21
Use promo code "24111" to get your promotional price.
To receive the discount customers must purchase three of the same product at list price in a single order to receive 33% discount. There is no limit to the multiples of 3 that customers can buy. Use promo code ”24111” to get your promotional price
Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.
T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantity
Applications
• Sanger sequencing
• PCR amplification
T7 Primer Sequence: 5´- TAATACGACTCACTATAGGG- 3´
Shipping Conditions: Room Temperature
| T7 | |
| • T7 Promoter Primer (2 μg) Store in Freezer at –20°C. Guaranteed stable for 6 months when properly stored. |
|
| 5 ́d[TAATACGACTCACTATAGGG]3 ́ | |
| Room Temperature | |
| 2 μg | |
| Lyophilized |
| Primer | |
| 20-mer | |
| Gel-purified | |
| T7 | |
| PCR Amplification |
A lot number is required to show results for certificates. To find your lot number on previous orders use our order status area.
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
For Research Use Only. Not for use in diagnostic procedures.
