missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ T7 Promoter Primer

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available.

Brand:  Invitrogen™ N56002

236.01 EUR valid until 2025-03-21
Use promo code "24111" to get your promotional price.


Product Code. 11675591

  • 354.00 € / 2µg

Please to purchase this item. Need a web account? Register with us today!

Explore more special offers

Alert:

To receive the discount customers must purchase three of the same product at list price in a single order to receive 33% discount. There is no limit to the multiples of 3 that customers can buy. Use promo code ”24111” to get your promotional price

This item is not returnable. View return policy

Description

Description

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.

T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantity

Applications
• Sanger sequencing
• PCR amplification

T7 Primer Sequence: 5´- TAATACGACTCACTATAGGG- 3´

Order Info

Shipping Conditions: Room Temperature

TRUSTED_SUSTAINABILITY
Specifications

Specifications

T7
• T7 Promoter Primer (2 μg)

Store in Freezer at –20°C.
Guaranteed stable for 6 months when properly stored.
5 ́d[TAATACGACTCACTATAGGG]3 ́
Room Temperature
2 μg
Lyophilized
Primer
20-mer
Gel-purified
T7
PCR Amplification
Product Suggestions

Product Suggestions

Videos
SDS
Documents

Documents

Manuals

Certificates

Certificates

A lot number is required to show results for certificates. To find your lot number on previous orders use our order status area.

5 results found
Lot Number Certificate Type Date Catalog Number
Lot Number3026095 Certificate TypeCertificate of Analysis Date31/01/2025 Catalog NumberN56002
Lot Number2367811 Certificate TypeCertificate of Analysis Date29/01/2025 Catalog NumberN56002
Lot Number2481938 Certificate TypeCertificate of Analysis Date29/01/2025 Catalog NumberN56002
Lot Number2962267 Certificate TypeCertificate of Analysis Date26/01/2025 Catalog NumberN56002
Lot Number2979623 Certificate TypeCertificate of Analysis Date26/01/2025 Catalog NumberN56002
Special Offers

Special Offers

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title
Invitrogen™ T7 Promoter Primer > 2 μg

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Thank You! Your feedback has been submitted. Fisher Scientific is always working to improve our content for you. We appreciate your feedback.

For Research Use Only. Not for use in diagnostic procedures.